Synthetic Biology (OpenWetWare) PowerPoint Presentation

Slide 1 -

Synthetic Biology Lecture 1: Introduction to Synthetic Biology

Slide 2 -

What is Synthetic Biology? Genetic Manipulation? Genetic selection carried out for millenia (domestication of animals) Mendelian selection ‘rationalized’ process. Recombinant DNA

Slide 3 -

Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems

Slide 4 -

ppt slide no 4 content not found

Slide 5 -

Fumbling Around Current Systems are “Art”

Slide 6 -

Recombinant DNA

Slide 7 -

Genetic Tools

Slide 8 -

Scissors

Slide 9 -

Glue

Slide 10 -

Vectors

Slide 11 -

Synthesizing DNA

Slide 12 -

These are Tools, but…

Slide 13 -

We want to create complex systems

Slide 14 -

EE in the beginning

Slide 15 -

How useful is Maxwell?

Slide 16 -

Abstraction Works for E&M

Slide 17 -

Composability OK - suppose we have individual parts that work, can we actually put them together such that they work in a well-defined/predictable way?

Slide 18 -

Standardization Assembly Part “Definition” Interactions Load Input/Output Stability

Slide 19 -

Standardizing a “Part” BioBrick - standard ends, restrictions on internal sequence

Slide 20 -

Standard Assembly

Slide 21 -

Standard Assembly

Slide 22 -

Now we can share!

Slide 23 -

What constitutes a part? The DNA Sequence? The function?

Slide 24 -

Parts: Basic biological functions encoded as DNA

Slide 25 -

DNA Sequence TAATACGACTCACTATAGGGAGA (T7 promoter)

Slide 26 -

ppt slide no 26 content not found

Slide 27 -

Load: Imposing on our Hosts Parts don’t exist in a vacuum. Cells may dislike the parts, resulting in mutation or rejection Too much modification may result in cells that just give up and die

Slide 28 -

Standard Measurement

Slide 29 -

Our Parts aren’t necessarily Stable Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all) Antibiotic resistance, dependence

Slide 30 -

Application Goals Bacterial robotics Microbial factories Adding features to plants to reduce environmental requirements/impact

Slide 31 -

Cancer Destroying Robot

Slide 32 -

Adding Computation to Cells

Slide 33 -

Bacterial Communication Networks

Slide 34 -

Artemisinin

Slide 35 -

ppt slide no 35 content not found

Slide 36 -

ppt slide no 36 content not found

Slide 37 -

ppt slide no 37 content not found

Slide 38 -

Public Policy http://www.repeatfanzine.co.uk/Images/Impage/no%20gmo.jpg

Slide 39 -

Is the fear so Irrational? We claim we can make all sorts of cool things, why not something ‘evil’?

Slide 40 -

Major Risks

Slide 41 -

What is different now? Rapid Sequencing Lots of sequence data on the internet Protocols available online Fedex Synthesis Data on Pathogens?

Slide 42 -

The good news Major weaponized biological agents have existed for decades Virulence, resistance, transmissibility were all enhanced prior to SB. The major advantage of our approach is putting together well characterized components. Creating new pathogens would require a full scale research effort

Slide 43 -

Summary Engineering instead of Science Modularity and Abstraction are powerful techniques Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.